This is also alluded to in Scripture. Isa 34:16 Search and read from the Book of YHWH; not one of these misses, each not lacking her mate; for He has commanded my mouth, and by His Spirit He has assembled them. These 2 letter parent roots, for the most part, can’t be used in language without the adding of another letter to form the 3 letter root of which most are familiar with in the Hebrew language. This process happens through the means of messenger RNA. RNA is an exact copy of the DNA molecule where the helix ladder ‘unzips’ itself in order to make an exact copy. DNA then is a picture of the Father on His throne. The Messenger RNA is a picture of Messiah who comes to earth to bring many sons to Glory. This DNA to RNA and back to DNA process is also seen in the work of the Scribes who made exact copies of the Torah. DNA transcription DNA, Design, and the Origin of Life Charles B. Thaxton, Ph.D. “…the genetic code can be best understood as an analogue to human language. It functions exactly like a code — indeed, it is a code: it is a molecular communication system within the cell… In recent years, scientists have applied information theory to biology, and in particular to the genetic code… It provides a mathematical means of measuring information… The conclusion drawn from the application of information theory to biology is there exists a structural identity between the DNA code and a written language… Molecular biology has now uncovered an analogy between DNA and written human languages. It is more than an analogy, in fact: in terms of structure, the two are ‘mathematically identical.’…” http://www.redicecreations.com/specialreports/2006/03mar/holygrail.html “A team of Russian geneticists and linguists, researching the electromagnetic behavior of DNA, discovered that “junk” DNA is critical not only for the construction of our body but also in data storage and communication. The Russian team discovered that this 90% of our DNA follows the same rules of grammar, syntax and semantics as human languages. Their conclusion is that human language mirrors the structure of our DNA.” Hebrew grammar DNA works in the same way as the Hebrew language. Each Hebrew word traces back to a 2 letter ‘parent root.’ This parent root, for the most part, can’t be used in a sentence without the addition of a 3rd letter. Hebrew verbs require a 3 consonant root in order to be conjugated. This 3 letter root is called the ‘child root.’ The DNA helix is formed through the combination of 2 nucleotides. Adenine and Thymine or Cytosine and Guanine combinations. In order for amino acids of the genetic code to be formed into proteins the nucleotides must combine into 3 letter combinations to make ‘codons.’ The genetic code consists of 64 codons and the amino acids specified by these codons. When the DNA is in the nucleus, the DNA contains two letter pairs held together by hydrogen bonds. The letters are unable to form a body without leaving the nucleus and taking on a 3rd letter, just like the Hebrew language. In order to take on a 3rd letter the DNA helix must “unwind”, where it copies itself onto messenger RNA. The letters then make one long string of letters. Just like an ancient Torah scroll. The DNA strand is made of letters: ATGCTCGAATAAATGTGAATTTGA The letters make words: ATG CTC GAA TAA ATG TGA ATT TGA The words make sentences: These “sentences” are called genes. Genes tell the cell to make other molecules called proteins. Proteins allow a cell to perform special functions, such as working with other groups of cells to make hearing possible. NOVA - Ghost in Your Genes The DNA letters are “transcribed” by Messenger RNA, just as Scribes transcribed one Torah scroll onto another scroll. The messenger RNA is also called the Servant RNA. The Messenger RNA can go outside the nucleus, whereas the DNA must stay inside the nucleus. The DNA does not leave the nucleus in order to preserve the original copy. If the mRNA obeys the rules He will overcome the mutations (sins) of the world when He enters the cytoplasm. The mRNA leaves the nucleus through a hole called the gatekeeper, that prepares the way for the mRNA to leave the nucleus. When the mRNA leaves the nucleus it is translated. The 3 letters represent amino acids. There are 22 amino acids that are read by the ribosomes to produce protein. These amino acids are divided up into codons, from the English word code which traces back to the Hebrew word ‘sod’. Murray Eden of MIT one of the mathematicians attending the Wistar Institute Symposium (1966) “DNA, like other languages, cannot be tinkered with by random variational changes; if that is done, the result will always be confusion…No currently existing formal language can tolerate random changes in the symbol sequences which express its sentences. Meaning is invariably destroyed.” You can not add or take away from the DNA or a mutation results Deu 12:32 All the things that I command you, take heed to do them and you shall not add to it, nor take away from it. Mat 5:17 Do not think that I came to annul the Law or the Prophets; I did not come to annul, but to fulfill. The genetic information that is read by the ribosomes determines what will be formed. Interestingly, tracing back the word ‘information’ brings forth the same concept. The English word ‘information’ comes from the Latin word ‘informare’ which means to shape, form, train, instruct, educate, etc. Informare breaks down from ‘in’ meaning into and ‘forma’ meaning a form. The English word form comes from the Old French word ‘forme’ which means a physical form, appearance, shape, image etc. This traces to the Latin word ‘forma’ which further traces to the Greek word ‘morphe’ meaning form, beauty, outward appearance. This word ‘morphe’ is interesting as it is used in only a few places in the New Testament, all of which are referring to Messiah. (Mark 16:12; Philippians 2:6-7; Galatians 4:19). ‘Morphe’ comes from the root ‘meros’ which means the constituent parts of a whole. Combining small parts to make an image, this describes DNA becoming protein (image) very well. Morphe is used to translate multiple words, all of which link to the current study. G3444 morphe H2122 ziv – an image that stands out morphe H6754 tselem – shadow, image morphe H8389 toar – mark or image, discussed in greater detail above. morphe H8403 tavnit – image, pattern- the word used for pattern in reference to the Tabernacle/Temple of YHWH. The significance of this has been discussed throughout this series of studies in reference to Messiah and His body. morphe H8544 temunah – Image, form- the root of this word is ‘מן’ which means ‘living waters/blood’ usually translated as type or kind which is linked to the passing of genes from father to son through ‘the blood.’ Epigenome The significance and importance of the epigenome has only recently been discovered by scientists. The genetic material which makes our eyes, ears, nose, feet, liver, heart etc., are all the same. It is the epigenome that translates this information to make each part what it is. This corresponds to the Holy Spirit. The Scriptures can be read by anyone yet it is only through the Holy Spirit that one can understand and see the ‘image’ of Elohim. Interestingly, the epigenome doesn’t alter the DNA sequence, it ‘turns on’ or ‘turns off’ different parts of the sequence. A good example of this is cancer. Cancer may be caused by several different mutations or epigenetic changes that cause genes to be expressed (turned on) and/or silenced (turned off) when they should not be. Cancer is an aberration in the cells which leads to death which can be caused by mutations (adding or taking away) or by certain parts of the ‘Word’ being ‘turned on or off.’ Not only does changing the Word lead to death, but misinterpretation of the Word. Rom 7:24 O wretched man that I am! Who shall deliver me from the body of this death? Rom 7:25 I thank God through Jesus Christ our Lord! So then I myself with the mind truly serve the Law of God, and with the flesh the law of sin. The epigenome that ‘translates’ the genetic code is likened to the Spirit. The Holy Spirit teaches man and leads him to interpret the Word correctly where he can be formed into the Image of Messiah. (2 Corinthians 3:18; Galatians 4:19; Romans 8:29) whereas the spirit of evil works in the children of disobedience where the Word is corrupted and leads to them being formed into the corrupted man of sin (Ephesians 2:2-3; Isaiah 1:4; 57:4; 1 Peter 1:13-16). Interestingly, DNA is dwelling in the midst of a matrix of water. The fact that it is in water plays a crucial role in how it gets its helix ladder shape. Because the four DNA bases are insoluble in water, they turn towards the interior molecule to form and join the two letter ‘roots.’ They then wrap themselves around each other to avoid contact with their wet environment. The epigenome is then likened to the Spirit hovering over the waters in the beginning. Gen 1:2 And the earth was without form, and void; and darkness was upon the face of the deep. And the Spirit of God moved upon the face of the water. Gen 1:3 And God said, Let there be light; and there was light. Psalm 139 speaks of man being formed in the womb and on a deeper level alludes to the DNA molecule. Psa 139:15 My bones were not hidden from You when I was made in secret; when I was woven* in the depths of the earth. *רקם râqam…this words means fashion, needlework or twisted threads (DNA). Psa 139:16 Your eyes saw my embryo; and in Your book (an allusion to DNA the ‘book of life’) all my members were written the days they were formed, and not one was yet among them. Here we seen that the womb is likened to the earth. In Hebraic thought, the womb is also likened to waters. As will be seen below, DNA also produces ‘light.’ Here we see a replay in our very cells of the beginning of the universe. Ribosomes The ribosomes ‘read’ the 22 amino acids in order to form proteins. Ribosomes are a picture of Scribes. The word ribosome comes from ribose which is a ‘sugar’ that is formed from ‘gum arabic.’ Tracing back this word gum brings forth some interesting connections to scribes. Gum arabic comes forth from the acacia tree mentioned above and is used in the process of making ink for ancient Torah scrolls. More on this below. In the Scriptures, gum comes forth from חלבנה ‘chalvanah.’ This is translated as ‘galbanum’ as in Exodus 30:34. ‘Chalvanah’ comes from the root ‘chalav’ which means the fat or choicest part. This was what was offered to YHWH on the altar along with the kidneys and liver (Exodus 29:13). Interestingly, the English word liver comes from the Hebrew word ‘chalav.’ This is also the origin of the English word ‘lip’ which is made up of fatty tissue. The word ‘lobe’ as in the ear lobe comes from ‘chalav’ as well. It is not hard to see the connection between lips, hearing (earlobe) and scribes (Proverbs 8:6). The English word ‘gum’ comes from the Hebrew גם ‘gam.’ The connection between ‘gam’ and scribes/the Word is seen in more detail in Messiah in the Torah: Genesis 1:9-13click here. Gam has the meaning of a collection of a group of animals at a watering hole, in particular camels as seen in Genesis 24. Gam (gimmel) is the number 3 in Hebrew which is linked to resurrection and maturity which is a major theme of the current study on the mark. Gamal is also the word for a camel which is used as a descriptive tool of satan in Kabbalistic writingsclick here. Here is seen the counterfeit of the ribosome or scribe. Corrupting the word/DNA to bring forth a counterfeit image/protein. The Hebrew letter gimel originally was pronounced as gam. Ancient Hebrew Lexicon of the Bible pg 22 This links back to baptism, as seen above, as the meaning of collecting at the waters. To further illustrate this, the word ‘agam’, which comes from the root ‘gam’ is translated as pool in English, just as miqveh (baptism) is. Amazingly, the account of Moshe being drawn out of the waters after being hidden for 3 months is linked to this word. Exo 2:3 And she was not able to hide him any longer, and she took a basket for him made of papyrus (Hebrew ‘gome’ גמא), and she daubed it with bitumen and with pitch. And she put the child in it, and placed it in the reeds by the lip of the Nile. The Hebrew letter gimmel/gam is a pictograph of a foot but also represents a camel. The Holy Scriptures link the camel to the gathering of the waters: Gen 24:11 And he made the camels kneel* outside the city, by a well of water at the time of the evening, the time that women go out to draw. *In Hebrew this word is barakh which connects with the word gamal/miqveh through the English word ‘pool.’ The word pool is translated from 3 different Hebrew words. Agam, miqveh, and berakah. This word comes from the root: Notice that the parent root of this word is בר, bar. This is the word for Son (Psalm 2:12). It is also the root for the word for soap. Washing of the body, as well as washing of the clothing points to Messiah. At Mt. Sinai, Yisrael was to was their clothing and be ready for the 3rd day when they would meet YHWH. Interestingly, the human body was designed to bathe with soap every 2-3 days. The word above, ‘bar’, is translated as son in Psalm 2:12; Proverbs 31:2 & Daniel 3:25, and is used in reference to the Word in Psalm 19:8. The link here is clear. The need for the body & our clothing to bathe in water and soap is a picture of man needing to be covered in the garments of the Word/Yahushua.